View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_711 (Length: 214)
Name: NF10145A_low_711
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_711 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 24760498 - 24760293
Alignment:
Q |
9 |
tggacatcatacacctcagatttggtttgtttcactggtttggttgtaacctacacatcagatttaaaaattatatattgaggaaggggaaactaccatt |
108 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
T |
24760498 |
tggacaacatacacctcagatttggtttgtttcactggtttggttgtaacctacacatcaggtttaaaaattatattttgaggaaggggaaactaccatt |
24760399 |
T |
 |
Q |
109 |
aattattgtggcactaatggccatttacaactgctcttgaaggcattggaactcagtctcccaaaattacaataccaaacttttagtactaagctgacac |
208 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
24760398 |
aattatagtggcactaatggccatttacaactgctctcgaaggcattggaactcagtctcccaagattacaataccaaacttttagtactaagctgacac |
24760299 |
T |
 |
Q |
209 |
ctcatg |
214 |
Q |
|
|
|||||| |
|
|
T |
24760298 |
ctcatg |
24760293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University