View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_716 (Length: 213)
Name: NF10145A_low_716
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_716 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 6111149 - 6111322
Alignment:
| Q |
15 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111149 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
6111248 |
T |
|
| Q |
115 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111249 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
6111322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University