View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_718 (Length: 213)
Name: NF10145A_low_718
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_718 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 45729318 - 45729126
Alignment:
| Q |
18 |
catcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattatgaggggagcactgcaggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729318 |
catcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattatgaggggagcactgcaggta |
45729219 |
T |
|
| Q |
118 |
cctagggataatatgagacaatttactacgagaaggaatctcttcannnnnnnctctgcaacttgttttttaccatcttccatgtgtgtgttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729218 |
cctagggataatatgagacaatttactacgagaaggaatctcttcatttttttctctgcaacttgttttttaccatcttccatgtgtgtgttc |
45729126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 45725129 - 45724991
Alignment:
| Q |
18 |
catcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattatgaggggagcactgcaggta |
117 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| | || || |
|
|
| T |
45725129 |
catcaaggggaaaccggcagtttccaggcaggcggagagccagacacgttggccgccgtggatgaaatagagacgcattattaggggaccaccggagtta |
45725030 |
T |
|
| Q |
118 |
cctagggataatatgagacaatttactacgagaaggaat |
156 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
45725029 |
cctagggctaatatcagacaatttactatcagaaggaat |
45724991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University