View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_719 (Length: 213)
Name: NF10145A_low_719
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_719 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 9436533 - 9436711
Alignment:
| Q |
13 |
acatcaacttaattgttttcttattatatctacattggtccccttcatcaatggccttgaaagctatcaactatgctaagatgctccatactaagatgct |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9436533 |
acattaacttaattgttttcttattatatctacattggtccccttcatcaatggccttgaaagctatcaactatgctaagatgctccatactaagatgct |
9436632 |
T |
 |
| Q |
113 |
tcaatgaaaaatacagacaacataaggaggcaacatatctgagatgcaaattcacaaatctgacggtttcttggatttt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
9436633 |
tcaatgaaaaatacagacaacataaggaggcaacatatctgagaagcaaattcacaaatttgacggcttcttggatttt |
9436711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University