View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_729 (Length: 211)
Name: NF10145A_low_729
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_729 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 114 - 196
Target Start/End: Complemental strand, 5829172 - 5829090
Alignment:
| Q |
114 |
aggggacttcaacttaactgtgaatttgtttctgagtctaatactctattgtgggtgatatcacccttctacaatttgatgtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5829172 |
aggggacttcaacttaactgtgaatttgtttctgagtctaatactctattgtgggtgatatcacccttctgcaatttgatgtg |
5829090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 88
Target Start/End: Complemental strand, 5829210 - 5829175
Alignment:
| Q |
53 |
aaaatgtaggatgcgtgttatcaccacatacttttt |
88 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5829210 |
aaaatttaggatgcgtgttatcaccacatacttttt |
5829175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University