View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_736 (Length: 209)
Name: NF10145A_low_736
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_736 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 32892033 - 32891866
Alignment:
| Q |
14 |
acatcaaattgctgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaagttttctggtcatgttagaaaattcttgc |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892033 |
acatcaaattgttgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaagttttctggtcatgttagaaaattcttgc |
32891934 |
T |
|
| Q |
114 |
ggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgttgggtggggggat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891933 |
ggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgttgggtggggggat |
32891866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University