View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_739 (Length: 208)
Name: NF10145A_low_739
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_739 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 44211393 - 44211565
Alignment:
| Q |
18 |
acatcataggcagtgttatatggctccaactcaaccaattttgtagctgcaaactcactgaattccaagtcaccaagagatttcgaaccaagcaacaagg |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
44211393 |
acataataggcagtgttatatggctccaactcaaccaattttgtagccgcaaactcactgaattccaagtcatcacgagatttcgaaccaagcaataagg |
44211492 |
T |
|
| Q |
118 |
atccccacatagctgccgtcggctcaaacggcatacatttgatgatgtcaaaagcctcttgcaattgaccagc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44211493 |
atccccacatagctgccgtcggctcaaacggcatacatttgatgatgtcaaaagcctcttgcaattgaccagc |
44211565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University