View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_742 (Length: 208)
Name: NF10145A_low_742
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_742 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 31 - 155
Target Start/End: Complemental strand, 47358771 - 47358647
Alignment:
| Q |
31 |
attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358771 |
attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg |
47358672 |
T |
|
| Q |
131 |
tctgcctgacttgtaaagctttgta |
155 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47358671 |
tctgcctgacttgtaaagctttgta |
47358647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University