View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_744 (Length: 208)
Name: NF10145A_low_744
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_744 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 38031779 - 38031572
Alignment:
| Q |
1 |
gacagaagtaaaacccctaacgaagattagatcattatgagagttttaagtagctaacacctaggacccaactcccaaatgactaaagaaaagcgaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38031779 |
gacagaagtaaaacccctaacgaagattagatcattatgagagttttaagtagctaacacctaggacccaactcccaaatgactaaagaaaagcgaaaaa |
38031680 |
T |
|
| Q |
101 |
agacacaacgagacccaaattgccaacccaatcatcccattatcggtaccccacaagaataatattcgtaagaaataaaatggggatccgtttactacaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38031679 |
agacacaacgagacacaaattgccaacccaatcatcccattatcggtaccacacaagaataatattcgtaagaaataaaatggtgatccgtttactacaa |
38031580 |
T |
|
| Q |
201 |
cggattac |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
38031579 |
cggattac |
38031572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University