View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_745 (Length: 207)
Name: NF10145A_low_745
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_745 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 21 - 182
Target Start/End: Original strand, 37894851 - 37895012
Alignment:
| Q |
21 |
ttctgtagtctgcacctggatttctctagcgtaattttcagctcaagcttgagagtcttgcttcatggcaaacatctgacttcacctaggaggcctctcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37894851 |
ttctgtagtctgcacctggatttctctagcgtaattttcagctcaagcttcagagtcttgcttcttggcaaacatctgacttcacctaggaggcctctcc |
37894950 |
T |
 |
| Q |
121 |
aatgaagtccaaccaaacctaccttttctaaaatctgacaagacacggtatgctgcttgatg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37894951 |
aatgaagtccaaccaaacctaccttttctaaaatctgacaagacacggtatgctgcttgatg |
37895012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University