View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_752 (Length: 206)
Name: NF10145A_low_752
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_752 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 36173032 - 36173212
Alignment:
| Q |
1 |
tattccattcagcctccctagttctagagcctgagtgaaaaatagtgcactccgnnnnnnnnnnnnnnnn----acagaagcacattctattgttttatt |
96 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36173032 |
tattccattcagcctcccaagttctagagcctgagtgaaaaatagtgcactccattttttttttttttttttttacagaagcacattctattgttttatt |
36173131 |
T |
|
| Q |
97 |
actgcaattactgaagtacactttattgttatcaaactgaatgttacgccaaaaaagataactacgtttagtgggggtctg |
177 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36173132 |
actggaattactgaagtacactttattgttatcaaactgaatgttgcgccaaaaaagataactacgtttagtgggtgtctg |
36173212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University