View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_761 (Length: 204)
Name: NF10145A_low_761
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_761 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 6715480 - 6715306
Alignment:
| Q |
11 |
gatggacatcacacgtggagtagtggcaaatggaagatgctgctttgtgtgtgctgagtcataatcaatattaaactatgtgcggtgtggtgaaaatatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715480 |
gatggacatcacacgtggagtagtggcaaatggaagatgctgctttgtgtgtgctgagtcataatcaatattaaactatgtgcggtgtggtgaaaatatg |
6715381 |
T |
|
| Q |
111 |
gtgccttcacaattcagaatcagattcatttcattggtccatgtttttaggatctttcttctgcttcttcttctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715380 |
gtgccttcacaattcagaatcagattcatttcattggtccatgtttttaggatctttcttctgcttcttcttctt |
6715306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University