View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_769 (Length: 201)
Name: NF10145A_low_769
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_769 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 24 - 185
Target Start/End: Original strand, 7355477 - 7355638
Alignment:
Q |
24 |
cgacaatcgcgacgagaaatgcggcagcgagtcctttattcacaaatcgcaaacccaagaagtcaaaaccagtaccgtcaccatcgttgtacacacattc |
123 |
Q |
|
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
7355477 |
cgacaatcgcgacgagaaatgcagcggcgagtcctttattcacaaatcgcaaacccaagaagtcaaaaccagtaccgtcaccatcgttgtacacatattc |
7355576 |
T |
 |
Q |
124 |
gatctccctttatgctggcgtgtcccttttcggaggctagtgatgcccatgtactgaacacc |
185 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
7355577 |
gatctccctttatgctggcgtgtcccttttcggaggttagtgatgcccatgtactgaacacc |
7355638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University