View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_770 (Length: 201)
Name: NF10145A_low_770
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_770 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 8519873 - 8519699
Alignment:
Q |
15 |
acatcagcataaacaatagaaaactctataaaatggacttcgatgtttcactctctttaaaaccttcaataagcagtcagtctcatgagcaacttgtcaa |
114 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8519873 |
acatcagcataaacaatagaagactctataaaatggacttcgatgtttcactctctttaaaaccttcaataagcagtcagtctcatgagcaacttgtcaa |
8519774 |
T |
 |
Q |
115 |
tttcatgagaataaagttaacgcagcaaacgagtatggcagagacaaggttaaaccaacccaacgaacaccaaac |
189 |
Q |
|
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8519773 |
tttcgtgagaatgaagttaacgcagcaaacgagtatggcagagacaaggttaaaccaacccaacgaacaccaaac |
8519699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University