View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_774 (Length: 201)
Name: NF10145A_low_774
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_774 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 3294438 - 3294270
Alignment:
| Q |
18 |
aaactagtgtttgcttaatgagaaaaaagtatcatagatacccacattttcatgtttcatgttgtaatattattactgcatagcactggtatctcatatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294438 |
aaactagtgtttgcttaatgagaaaaaagtatcatagatatccacattttcatgtttcatgttgtaatattattactgcatagcactggtatctcatatg |
3294339 |
T |
|
| Q |
118 |
gatttgtttccgatatgctatctttttagatgctttctcagcgtgtgtttcccttggatttctctcttt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294338 |
gatttgtttccgatatgctatctttttagatgctttctcagcgtgtgtttcccttggatttctctcttt |
3294270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University