View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_775 (Length: 201)
Name: NF10145A_low_775
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_775 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 26418802 - 26418627
Alignment:
| Q |
15 |
gacatcagagctgcttattgtctccacatgttgcaccaaaaccttcttgttatgaatttccactgaaaaggaagggagaaaattatatcgttagtcaggc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26418802 |
gacatcagagctgcttattgtctccacatgttgcaccaaaaccttcttgttatgaatttccactgaaaaggaagggagaaaattatatcgttagtcaggc |
26418703 |
T |
 |
| Q |
115 |
ataaatattgaacacgcatgcagaagaagaaaaagat-------aaaaacaaatccgacggttttcagctcttcat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
26418702 |
ataaatattgaacacgcatgcagaagaaaaaaaaaataaaaaaaaaaaacaaatccgacggttttcagctcttcat |
26418627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 22 - 115
Target Start/End: Complemental strand, 12290501 - 12290408
Alignment:
| Q |
22 |
gagctgcttattgtctccacatgttgcaccaaaaccttcttgttatgaatttccact-gaaaaggaagggagaaaattatatcgttagtcaggca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| || ||||||||| |
|
|
| T |
12290501 |
gagctgcttattgtctccacatgttgcaccaaaaccttcttgttatgaatttccactaaaaaaggaagggag-caattatattgtgagtcaggca |
12290408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 12276428 - 12276524
Alignment:
| Q |
19 |
tcagagctgcttattgtctccacatgttgcaccaaaaccttcttgttatgaatttccactgaaaaggaagggagaaaattatatcgttagtcaggcat |
116 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| ||| |||||||| |||| |||||||||||||| ||||||| |
|
|
| T |
12276428 |
tcagagctgcttattgtcttcagatgttgcaccaaaaccttcttgttatgaaattctactaaaaaggaaaggag-gaattatatcgttaggcaggcat |
12276524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University