View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145_low_4 (Length: 264)
Name: NF10145_low_4
Description: NF10145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 6917730 - 6917497
Alignment:
| Q |
18 |
atttactcgcttgcagcgacgaaagatttattatacaccggttctgatagtaaaaacattcgtgtttggaagaatcaaaaggaattcgctggttttaaat |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6917730 |
atttactcgcttgcagcgacgaaggatttattatacaccggttctgatagtaaaaacattcgtgtttggaagaatcaaaaggaattcgcgggttttaaat |
6917631 |
T |
 |
| Q |
118 |
caaatagtggtttagttaaagcaattgttatagccggtgagaagattctcaccggccatcaagatggaagaattcgtgtttggagagtttcaaacaagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917630 |
caaatagtggtttagttaaagcaattgttatagccggtgagaagattctcaccggccatcaagatggaagaattcgtgtttggagagtttcaaacaagaa |
6917531 |
T |
 |
| Q |
218 |
tgaacaaacttatagaagagccgcgacattgcct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6917530 |
tgaacaaacttatagaagagccgcgacattgcct |
6917497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University