View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10146_high_13 (Length: 268)
Name: NF10146_high_13
Description: NF10146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10146_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 6 - 252
Target Start/End: Original strand, 45345443 - 45345689
Alignment:
| Q |
6 |
caaagggaacacgagtcatattggtgctacaagggcaatttaaatatctacctgcaccgctaataggtgtagttcggattgctgagatttgttgtgacgg |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45345443 |
caaaaggaacacgagtcatattggtgctacaagggcaatttaaatatctacctgcaccgctaataggtgtagttcggattgccgagatttgttgtgacgg |
45345542 |
T |
 |
| Q |
106 |
aggtccactgtccttggagaagacctatatagaatgaacaagatataagcacacaaacaaatacctgcaaatgaatcttattgatcaattagatcaagtt |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345543 |
aggtccactgtccttggaaaagacctatatagaatgaacaagatataagcacacaaacaaatacctgcaaatgaatcttattgatcaattagatcaagtt |
45345642 |
T |
 |
| Q |
206 |
ggtatgaattataaaagggaatgataaagactatattcagttgaact |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345643 |
ggtatgaattataaaagggaatgataaagactatattcagttgaact |
45345689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University