View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10146_high_14 (Length: 254)
Name: NF10146_high_14
Description: NF10146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10146_high_14 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 91 - 254
Target Start/End: Original strand, 3515145 - 3515325
Alignment:
Q |
91 |
tttggcatctcttcactctcagttatcccttagttacttggatgatacttgcgtggaaactaatatgaagtcgtatcctgcgcatctaaa---------- |
180 |
Q |
|
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3515145 |
tttggcatctcttcactctcagttagtctttagttacttggatgatacttgcgtggaaactaatatgaagtcgtatcctgcgcatctaaatttcctcaag |
3515244 |
T |
 |
Q |
181 |
-------tacttggatctcattatagcagtcttcttttggtggtctggttcgggaccccaatagtagtttcgtttgcagtt |
254 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
3515245 |
tttaatgttgttggatctcattatagcagtcttcttttggtggtctcgttcgggaccccaatagtagtttcgtttgcagtt |
3515325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 3515027 - 3515106
Alignment:
Q |
17 |
tgaatttacaaaatacatatattggttctaggccccggccccggcccctagtcttcggtatcatactaacagggtttggc |
96 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
T |
3515027 |
tgaatttacaaaatacatatattggttctaggccctggccttggcccctagtcttcagtatcatactaacagggtttggc |
3515106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University