View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10146_high_19 (Length: 241)
Name: NF10146_high_19
Description: NF10146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10146_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 12194863 - 12195088
Alignment:
| Q |
1 |
caatctagagacataattcagtttattttgatgagtagcaaatttttattctttttgaaatcataaaaccctgatccttcacttttacttaaattatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
12194863 |
caatctagagacataattcagtttattttgatgagtagcaaatttttattctttttgaaatcataaaatcctgatccttcacttttactcaaattatata |
12194962 |
T |
 |
| Q |
101 |
tgtccgttgtcttaagatagatggacatttatatgaaagtcttggtttgattcaagttgagtaaaatatggtcaaatttggggattaaaaatacatagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12194963 |
tgtccgttgtcttaagatagatggacatttatatgaaagtcttggtttgattcaagttgagtaaaatatggtcaaatttggggattaaaaatacatagta |
12195062 |
T |
 |
| Q |
201 |
tttata-tttgcttatgtcatataag |
225 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
12195063 |
tttatattttgcttatgtcatataag |
12195088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University