View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10146_low_20 (Length: 254)

Name: NF10146_low_20
Description: NF10146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10146_low_20
NF10146_low_20
[»] chr8 (2 HSPs)
chr8 (91-254)||(3515145-3515325)
chr8 (17-96)||(3515027-3515106)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 91 - 254
Target Start/End: Original strand, 3515145 - 3515325
Alignment:
91 tttggcatctcttcactctcagttatcccttagttacttggatgatacttgcgtggaaactaatatgaagtcgtatcctgcgcatctaaa---------- 180  Q
    |||||||||||||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||              
3515145 tttggcatctcttcactctcagttagtctttagttacttggatgatacttgcgtggaaactaatatgaagtcgtatcctgcgcatctaaatttcctcaag 3515244  T
181 -------tacttggatctcattatagcagtcttcttttggtggtctggttcgggaccccaatagtagtttcgtttgcagtt 254  Q
           |  |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
3515245 tttaatgttgttggatctcattatagcagtcttcttttggtggtctcgttcgggaccccaatagtagtttcgtttgcagtt 3515325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 3515027 - 3515106
Alignment:
17 tgaatttacaaaatacatatattggttctaggccccggccccggcccctagtcttcggtatcatactaacagggtttggc 96  Q
    ||||||||||||||||||||||||||||||||||| ||||  |||||||||||||| |||||||||||||||||||||||    
3515027 tgaatttacaaaatacatatattggttctaggccctggccttggcccctagtcttcagtatcatactaacagggtttggc 3515106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University