View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10147_low_3 (Length: 320)
Name: NF10147_low_3
Description: NF10147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10147_low_3 |
 |  |
|
| [»] chr4 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 6e-68; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 182 - 320
Target Start/End: Original strand, 22009652 - 22009790
Alignment:
| Q |
182 |
tgatgactcctcaaaatatgaaagcttgccagctcttcaatcgggacaggagcgagggttctgccaagcacaaaatacttgtcatttcaagacgcttgtg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22009652 |
tgatgactcctcaaaatatgaaagcttgccagctcttcaatcgggacaggagcgagggttctgccaagcacaaaatacttgtcatttcaagacacttgtg |
22009751 |
T |
 |
| Q |
282 |
tgtcctgaagagtgtaaacaaaggaagccaaagaagaac |
320 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22009752 |
tgtccggaagagtgtaaacaaaggaagccaaagaagaac |
22009790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 15 - 104
Target Start/End: Original strand, 22009497 - 22009586
Alignment:
| Q |
15 |
ggcaacggtaatggtaacaacggtaacaatggcaacggtaacggaaatggtaatggtaagggtaacaacggaaacggtaagggaaatgat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22009497 |
ggcaacggtaatggtaacaacggtaacaatggcaacggtaagggaaatggtaatggtaagggtaacaacggaaacggtaagggaaatgat |
22009586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 21992134 - 21992206
Alignment:
| Q |
32 |
caacggtaacaatggcaacggtaacggaaatggtaatggtaagggtaacaacggaaacggtaagggaaatgat |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||| || || ||||||||||||||| |
|
|
| T |
21992134 |
caacggtaacaatggcaacggtaagggaaatggtaatggtaatggtaacaatggcaatggtaagggaaatgat |
21992206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 320
Target Start/End: Original strand, 21992315 - 21992410
Alignment:
| Q |
225 |
ggacaggagcgagggttctgccaagcacaaaatacttgtcatttcaagacgcttgtgtgtcctgaagagtgtaaacaaaggaagccaaagaagaac |
320 |
Q |
| |
|
||||||||||||| |||||| ||||| | ||||| ||||||||| ||| ||||||||||| | |||||| ||| |||||||||||||||||| |
|
|
| T |
21992315 |
ggacaggagcgagcattctgcaaagcaaacaatacctgtcatttcgcgacccttgtgtgtccagcagagtgcaaaaccaggaagccaaagaagaac |
21992410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 21992120 - 21992165
Alignment:
| Q |
57 |
ggaaatggtaatggtaagggtaacaacggaaacggtaagggaaatg |
102 |
Q |
| |
|
|||||||||||||| || |||||||| || |||||||||||||||| |
|
|
| T |
21992120 |
ggaaatggtaatggcaacggtaacaatggcaacggtaagggaaatg |
21992165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University