View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_23 (Length: 347)
Name: NF10148_low_23
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 98 - 338
Target Start/End: Original strand, 30170865 - 30171105
Alignment:
| Q |
98 |
cataattaatggctaaaatggcaagtatgaaattagcatatacaataaaatattgtgttttgaatcagttctttttgttcatgttcctcctcactgcctc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30170865 |
cataattaatggctaaaatggcaagtatgaaattagcatatacaataaaatgttgtgttttgaatcagttctttttgttcatgttcctcctcactgcctc |
30170964 |
T |
 |
| Q |
198 |
agcattatctttgacatactcagctgattgtttagttttttcagaagccttatcagaaacactatctgcccttgcctctgcctctgcctttccatctgcg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30170965 |
agcattatctttgacatactcagctgattgtttagttttttcagaaaccttatcagaaacactatctgcccttgcctctgcctctgcctttccatctgcg |
30171064 |
T |
 |
| Q |
298 |
caagtctgttttacattctcagcagccctatctgcctttgc |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30171065 |
caagtctgttttacattctcagcagccctatctgcctttgc |
30171105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 30170785 - 30170832
Alignment:
| Q |
18 |
ggaagaaacatgcatcttctccatatacattttgtgccttatcaatta |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30170785 |
ggaagaaacatgcatcttctccatatacattttgtgccttatcaatta |
30170832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 259 - 323
Target Start/End: Original strand, 30171092 - 30171156
Alignment:
| Q |
259 |
ctatctgcccttgcctctgcctctgcctttccatctgcgcaagtctgttttacattctcagcagc |
323 |
Q |
| |
|
||||||||| |||||||| ||||||| ||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
30171092 |
ctatctgcctttgcctctacctctgcttttccatctgcacaagtctgttttacactgtcagcagc |
30171156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University