View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_24 (Length: 344)
Name: NF10148_low_24
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 125 - 334
Target Start/End: Complemental strand, 39126338 - 39126128
Alignment:
| Q |
125 |
attgttgtgtagattcgattcaagcttgttaatggcggtggagttgatgcggggaagaacactggaaattgcacgcatgttattgttgataaaattgctt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39126338 |
attgttgtgtagattcgattcaagcttgttaatggcggtggagttgatgcggggaagaacactggaaattgcacgcatgttattgttgataaaattgctt |
39126239 |
T |
|
| Q |
225 |
atgtcagttcgaaacccta-nnnnnnnnnncttttcgtttgtttattctctctaattttgacatgaaatgagtgaattctgtgttgttattgtaggacga |
323 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39126238 |
atgtcagttcgaaaccctatttttttctttcttttcgtttgtttattctctctaattttgacatgaaatgagtgaattctgtgttgttattgtaggacga |
39126139 |
T |
|
| Q |
324 |
tccggtctgtg |
334 |
Q |
| |
|
|||||| |||| |
|
|
| T |
39126138 |
tccggtgtgtg |
39126128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University