View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_25 (Length: 344)
Name: NF10148_low_25
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 42679112 - 42679304
Alignment:
| Q |
18 |
agtttgaattgctacataatacatgataaacatttagtatatgttttaattgtttctgacaatataatatcaacatgcttacnnnnnnnnnnnnatttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42679112 |
agtttgaattgctacataatacatgataaacatttagtatatgttttaattgtttctgacaatataatatcaacatgcttacttttttttttt-atttct |
42679210 |
T |
 |
| Q |
118 |
cttttaaattaaaattcatatctttgttctggttttgtatagtttctgctcagcgcacaaacaatttatttgtgcttgtttcttctgctttcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42679211 |
cttttaaattaaaattcatatctttgttctggttttgtatagtttctgctcagcgcacaaacaatttatttgtgcttgtttcttctgctttcac |
42679304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University