View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_26 (Length: 338)
Name: NF10148_low_26
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 36402671 - 36402993
Alignment:
| Q |
1 |
aaataaaaaacacttacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402671 |
aaataaaaaacacttacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacc |
36402770 |
T |
 |
| Q |
101 |
tgttattaatcttagcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccctatccaccgacacatgttcttcactacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402771 |
tgttattaatcttagcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccctatccaccgacacatgttcttcactacc |
36402870 |
T |
 |
| Q |
201 |
accttgaccacttgcacgtgcacttccaccagccatatttcttctgctagtaggagatggaataggatcaaaagggctgttatctaccacaatcgccaaa |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402871 |
accttgaccacttgcacgtgaacttccactagccatatttcttctgctagtaggagatggaataggatcaaaagggctgttatctaccacaatcgccaaa |
36402970 |
T |
 |
| Q |
301 |
ggattggtttcttccatcatatg |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36402971 |
ggattggtttcttccatcatatg |
36402993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 173
Target Start/End: Original strand, 21428795 - 21428953
Alignment:
| Q |
15 |
tacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaatctta |
114 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| ||| ||||||| |||||||| |||||||| || || || ||||||||||||| |||| |
|
|
| T |
21428795 |
tacctcaactttcatcatccatgaattagctttctgaacctgctcattctcccaaccattgataacagcatcttcccttttaaacctgttattaacctta |
21428894 |
T |
 |
| Q |
115 |
gcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccct |
173 |
Q |
| |
|
||||| ||||| || ||||| || | |||||| | ||||| || || ||||||||||| |
|
|
| T |
21428895 |
gcaaccttagcgttttgccatgcagctatcttggactcaacctcttctttcttcaccct |
21428953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University