View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_30 (Length: 320)
Name: NF10148_low_30
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 22331316 - 22331544
Alignment:
| Q |
17 |
caatgtcctcttgagagaaatgctcttctttaaggagataataataatgaaaataaagatgtagaaaaggccttgccctttattgagatcgtggaaatta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22331316 |
caatgtcctcttgagagaaatgctcttctttaaggagataataataatgaaaataaagatgtagaaaaggccttgccctttattgagatcgtggaaatta |
22331415 |
T |
 |
| Q |
117 |
tttt-ttggtcgatgctggtgcttccggggtcggttgacagataagattataccgaaaatcttgattggattattaggttgctaggtgtgaggagtggca |
215 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22331416 |
tttttttggtcgatgctggttcttccggggtcggttgacagataagattataccgaaaatcttgattggattattaggttgctatgtgtgaggagtggca |
22331515 |
T |
 |
| Q |
216 |
aatattttccttaaaataataatacgata |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22331516 |
aatattttccttaaaataataatacgata |
22331544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 266
Target Start/End: Original strand, 22331577 - 22331619
Alignment:
| Q |
224 |
ccttaaaataataatacgatacggtgccacatacacgtagtag |
266 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| |||||| |
|
|
| T |
22331577 |
ccttaaaataatcatacgatacggtaccacatacacatagtag |
22331619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University