View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_39 (Length: 280)
Name: NF10148_low_39
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 50918947 - 50918693
Alignment:
| Q |
18 |
gaagctagggttccattggcttacagagatcaatgcgctcatttgctcatccctctcaacaaatgcagacaagctgaattctatcttccatggaagtgcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50918947 |
gaagctagggttccattggcttacagagatcaatgcgctcatttgctcatccctctcaacaaatgcagacaagctgaattctatcttccatggaagtgcg |
50918848 |
T |
|
| Q |
118 |
agaatgaacgccactcttatgaaaagtgcgagtacgaactcgtcatggagagaatgcttcagatgcagaagatccgcgaaaatcaaaatgctaattccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50918847 |
agaatgaacgccactcttatgaaaagtgcgagtacgaactcgtcatggagagaatgcttcagatgcagaagatccgcgaaaatcaaaatgctaattccaa |
50918748 |
T |
|
| Q |
218 |
acaacccgttaccca------gggtgctgctattcctctcatccctaaacccgcc |
266 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50918747 |
acaacccgttacccagggtcagggtgctgctattcctctcatccctaaacccgcc |
50918693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 216 - 266
Target Start/End: Original strand, 29453076 - 29453126
Alignment:
| Q |
216 |
aaacaacccgttacccagggtgctgctattcctctcatccctaaacccgcc |
266 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
29453076 |
aaacaacccgttactcagggtgctgctattcctctcattcccaaacccgcc |
29453126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University