View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_42 (Length: 257)
Name: NF10148_low_42
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 38124727 - 38124486
Alignment:
| Q |
1 |
tgtttgcattcacaatttgtgctctagcgtttgcatatcgccactgaatcaaacggttatcaagcaaacggagcttacgaacgtcttcattatttccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
38124727 |
tgtttgcattcacaatttgtgctctagcgtttgcatatcgccactgaatcaaacggttatcaagcaaacgaagcttatgaacgtcttcattgtttccaaa |
38124628 |
T |
 |
| Q |
101 |
accattcgacggtgaattaaggccaacagattttttactcttgaagaaatcaaaaccaaaattgagtagtttttcaactcgttttgccttcgtggggctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124627 |
accattcgacggtgaattaaggccaacagattttttactcttgaagaaatcaaaaccaaaattgagtagtttttcaactcgttttgccttcgtggggctc |
38124528 |
T |
 |
| Q |
201 |
gaaaactctgacctccctggtgacaaagcccattgtgatgtc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124527 |
gaaaactctgacctccctggtgacaaagcccattgtgatgtc |
38124486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University