View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_44 (Length: 253)
Name: NF10148_low_44
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 238
Target Start/End: Original strand, 44064827 - 44065063
Alignment:
| Q |
10 |
gcacagagacaagctacatgaaaactcatatctgagctaagacaacctcttttcttttatgccaagtttcaataattttgattatttagccgcttatatt |
109 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44064827 |
gcacagacacaagctacatgaaaactcaaatctgagctaagacaacctcttttcttttatgccaagtttcaataattttgattatttagccgcttatatt |
44064926 |
T |
|
| Q |
110 |
gcttccag---------gaaaatgtttggagagaaaaagagagtaaatgtgaaagagagatagaaaccaaatgagatcgtgttgaatgaatgtcagggaa |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44064927 |
gcttccattattgataagaaaatgtttggagagaaaaagagagtaa-tgtgaaagagagatagaaaccaaatgagatcatgttgaatgaatgtcagggat |
44065025 |
T |
|
| Q |
201 |
tatgagatgtttgtgtattattgttgtataaatgaaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44065026 |
tatgagatgtttgtgtattattgttgtataaatgaaat |
44065063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University