View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_48 (Length: 247)
Name: NF10148_low_48
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10148_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 34713840 - 34713776
Alignment:
Q |
16 |
ataagtaccatgcatttacgttaagaatgttttactattttaaaaattatatacccaacttattc |
80 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34713840 |
ataagtaccatgcatttacgttaagaatgttttactattttaaaaattatatacccaacttattc |
34713776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 148
Target Start/End: Complemental strand, 34713747 - 34713706
Alignment:
Q |
107 |
ctgaaagtaataatattaaacaatttgtattgttttctgtac |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34713747 |
ctgaaagtaataatattaaacaatttgtattgttttctgtac |
34713706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University