View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_49 (Length: 246)
Name: NF10148_low_49
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 48464059 - 48464297
Alignment:
| Q |
1 |
tgatccacaggggcctatgcttcagaaatggaacaaaatctttgtactcacatgtgtgctggcaatttctgtggacccttttttcttttacattccagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48464059 |
tgatccacaggggcctatgcttcagaaatggaacaaaatctttgtaatcacatgtgtgctggcaatttctgtggacccttttttcttttacattccagtg |
48464158 |
T |
|
| Q |
101 |
attgtcggtaaacaaaaatgtcttgatttggatggaacattgcagactactatcagtgttcttcgcacgttcttcgatcttttctacattcttcgcatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48464159 |
attgtcggtaaacaaaaatgtcttgatttggatggaacattgcagactactatcagtgttcttcgcacgttcttcgatcttttctacattcttcgcatca |
48464258 |
T |
|
| Q |
201 |
tctttcagttcagaaccggatttattgcgccttcatctc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48464259 |
tctttcagttcagaaccggatttattgcgccttcttctc |
48464297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 20 - 234
Target Start/End: Complemental strand, 10068273 - 10068059
Alignment:
| Q |
20 |
cttcagaaatggaacaaaatctttgtactcacatgtgtgctggcaatttctgtggacccttttttcttttacattccagtgattgtcggtaaacaaaaat |
119 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||||||| ||||| | ||| |||| || || ||||||||||| || ||||||| | | ||||| |
|
|
| T |
10068273 |
cttcagaaatggaacaagatctttgttataacatgtgtgatggcagtatctatggatccattattcttttacatccctgtgattgatgaccagagaaaat |
10068174 |
T |
|
| Q |
120 |
gtcttgatttggatggaacattgcagactactatcagtgttcttcgcacgttcttcgatcttttctacattcttcgcatcatctttcagttcagaaccgg |
219 |
Q |
| |
|
| ||| ||||| ||||||||||| ||| |||| ||||||||||| ||||| |||||||||||||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
10068173 |
gccttaatttgaatggaacattgaagattactgctagtgttcttcggacgtttttcgatcttttctacattattcgcatcgtctttcagtttcgaaccgg |
10068074 |
T |
|
| Q |
220 |
atttattgcgccttc |
234 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
10068073 |
gtttattgcaccttc |
10068059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University