View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_51 (Length: 243)
Name: NF10148_low_51
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10148_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 38124835 - 38125050
Alignment:
Q |
1 |
aaataaacggaaactaggttactaagatgtcatggcattaactatttttataaccttgttaaaacaaagtttatgctataagacaagataagtggtaaat |
100 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38124835 |
aaataaactgaaactaggttactaagatgtcatgtcattaactatttttataaccttgttaaaacaaagtttatgctataagacaagataagtggtaaat |
38124934 |
T |
 |
Q |
101 |
aagctaattctaaatgcattatgtctcctttctttatgtgatctttatagctaatgagaaattgaattaacattatcttggtttatgaatgtttttagag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38124935 |
aagctaattctaaatgcattatgtctcctt-----------tctttatagctaatgagaaattgaattaacattatcttggtttatgaatgtttttagag |
38125023 |
T |
 |
Q |
201 |
caatttgatatgtgtctgggatggtct |
227 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
38125024 |
caatttgatatgtgtctgggatggtct |
38125050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University