View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_52 (Length: 242)
Name: NF10148_low_52
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 14288535 - 14288758
Alignment:
| Q |
1 |
tcatctccgacacaaaagacaaagttctgtagagataatttggttaatgctggcatatttagagaatttgggaataaagtgacatcatcacaattaggac |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
14288535 |
tcatctccgacacaaaagacaaagttccgtagagataatttggttaatgctggcatatttagagaatttgggaataaagtgatatcatcacgattaggac |
14288634 |
T |
 |
| Q |
101 |
gacaaacagaaagatgaagatgtgttaaaagttgagatgaaaataagcagcgtggtaaatgttgaacatcgcataagagattgatttctaattgcttgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14288635 |
gacaaacagaaagatgaagatgtgttaaaagttgagatgaaaataagcagcgtggtaaatgttgaacatcacataagagattgatttctaattgcttgac |
14288734 |
T |
 |
| Q |
201 |
attacgtgaaagggtgtataatat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14288735 |
attacgtgaaagggtgtataatat |
14288758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 52187289 - 52187232
Alignment:
| Q |
12 |
acaaaagacaaagttctgtagagataatttggttaatgctggcatatttagagaattt |
69 |
Q |
| |
|
||||||| |||||| || |||||| || |||||||||||||||| ||| ||||||||| |
|
|
| T |
52187289 |
acaaaagccaaagtactttagagacaagttggttaatgctggcaaattcagagaattt |
52187232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University