View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10148_low_53 (Length: 242)

Name: NF10148_low_53
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10148_low_53
NF10148_low_53
[»] chr5 (2 HSPs)
chr5 (1-203)||(10529638-10529840)
chr5 (200-240)||(10528894-10528934)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 10529840 - 10529638
Alignment:
1 tatagaaggaaaatggaagaaacttgatgattcacttattcaaatcacctcataatgaagaactgtacaactacgaaccaacttctgagtaactctaact 100  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
10529840 tatagaaggaaaatggaagaaacttgacgattcacttattcaaatcacctcataatgaagaacggtacaactacgaaccaacttctgactaactctaact 10529741  T
101 ttcttctaactaatctattgcttactaaaactaattataattttgctaacaaactcaaagtagttagttaatttcaacgatctcaataacttgcagttga 200  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10529740 ttcttctaactaatctattacttactaaaactaattataattttgctaacaaactcaaagtagttagttaatttcaacgatctcaataacttgcagttga 10529641  T
201 agt 203  Q
    |||    
10529640 agt 10529638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 10528934 - 10528894
Alignment:
200 aagtaacaactacaagtgtagttttgcactgcaatcctatg 240  Q
    ||||||||||||||||| |||||||||| ||||||||||||    
10528934 aagtaacaactacaagtatagttttgcagtgcaatcctatg 10528894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University