View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_57 (Length: 239)
Name: NF10148_low_57
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 7175040 - 7174818
Alignment:
| Q |
1 |
cttcccaaaattaaccaaaggccaatacattttcaatgcttgcactctctcttccctcatcacaacaaaaggggcggccaccgccatgcagcatcctctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7175040 |
cttcccaaaattaaccaaaggccaatacattttcaatgcttgcactctctcttccctcatcacaacaaaagggacggccaccgccatgcagcatcctctc |
7174941 |
T |
|
| Q |
101 |
aacattcgaaagttcgataaaatccgtggctcttgccacggcatcctctgtctcgaactccaccaaaggttcgctattttgtggaaccctttcattaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7174940 |
aacattcgaaagttcgataaaatccgtggctcttgccacggcatcctctgtctcgaactccaccaaaggttcgctattttatggaaccctttcattaata |
7174841 |
T |
|
| Q |
201 |
aatatgcaagtttgccccctttg |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
7174840 |
aatatgcaagtttgccacctttg |
7174818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 203
Target Start/End: Original strand, 11237185 - 11237261
Alignment:
| Q |
127 |
tggctcttgccacggcatcctctgtctcgaactccaccaaaggttcgctattttgtggaaccctttcattaataaat |
203 |
Q |
| |
|
|||||||||||| || ||||||||| ||| |||| | ||| | |||||| ||||||||||||||| |||||| |||| |
|
|
| T |
11237185 |
tggctcttgccatggtatcctctgtttcgcactcgatcaacgtttcgctcttttgtggaacccttccattaagaaat |
11237261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 11329679 - 11329730
Alignment:
| Q |
109 |
aaagttcgataaaatccgtggctcttgccacggcatcctctgtctcgaactc |
160 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||| |||||| || ||||| |
|
|
| T |
11329679 |
aaagttcgatcaaatccgtggctcttgccatggcattctctgtatcaaactc |
11329730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University