View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_62 (Length: 218)
Name: NF10148_low_62
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 22 - 135
Target Start/End: Original strand, 45161474 - 45161587
Alignment:
| Q |
22 |
gagagaagataaaatatttttatcttcttttgattttgtggagtactgtatgtgtataacaaattcacgtgacatatgtgatttttgtcacgcgttctgt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45161474 |
gagagaagataaaatatttttatcttcttttgattttgtggagtactgtatgtgtataacaaattcacgtgacatatgtgatttttgtcacgcgttccgt |
45161573 |
T |
|
| Q |
122 |
aaagtttatccaac |
135 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45161574 |
aaagtttatccaac |
45161587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 202
Target Start/End: Original strand, 45161609 - 45161659
Alignment:
| Q |
146 |
agtaaaatcatacaatatgcattgcatgagcatgactatagttatgagccactttct |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45161609 |
agtaaaatcatacaatatgcatt------gcatgactatagttatgagccactttct |
45161659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University