View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_63 (Length: 217)
Name: NF10148_low_63
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10148_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 30803693 - 30803895
Alignment:
| Q |
1 |
gaaagctctcttcatcgagtttaagccaggaatgatacattttggatgcctttgaggcaagccaaaggacaaaggtcacaaattaaagcagcatagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803693 |
gaaagctctcttcatcgagtttaagccaggaatgatacattttggatgcctttgaggcaagccaaaggacaaaggtcacaaattaaagcagcatagaagg |
30803792 |
T |
 |
| Q |
101 |
catctcaatcttgatctcaatggttgaaccatataattaggtatgtaccataaaattaatattatgtaactgaaggttcaaaatgcgcagctctccatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803793 |
catctcaatcttgatctcaatggttgaaccatataattaggtatgtaccataaaattaatattatgtaactgaaggttcaaaatgcgcagctctccatgc |
30803892 |
T |
 |
| Q |
201 |
ttt |
203 |
Q |
| |
|
||| |
|
|
| T |
30803893 |
ttt |
30803895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University