View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10148_low_64 (Length: 206)
Name: NF10148_low_64
Description: NF10148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10148_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 23 - 191
Target Start/End: Complemental strand, 45356564 - 45356396
Alignment:
Q |
23 |
ccccctcccccaaatgatgatgttgttgatacatatatatggcctctacagtttagcaacctcattctaaaatgtgtatattgtttgatgttgtttcaag |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45356564 |
ccccctcccccaaatgatgatgttgttgatacatatatatggcctctacagtttagcaacctcattctaaaatgtgtatattgtttgatgttgtttcaag |
45356465 |
T |
 |
Q |
123 |
tgtttatatgtgaacctagcagagcgttcaaaatttacaaatggagaaattcaaacatttatgtctgtg |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45356464 |
tgtttatatgtgaacctagcagagcgttcaaaatttacaaatggagaaattcaaacatttatgtctgtg |
45356396 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University