View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10149_high_5 (Length: 240)
Name: NF10149_high_5
Description: NF10149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10149_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 44130275 - 44130163
Alignment:
Q |
1 |
tacatagaatttgggtgtctaaaactctgacattcagaagtaaaaaatttgcaaagcactatattgtcggtttgttaatttttactgttaaacattgaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44130275 |
tacatagaatttgggtgtctaaaactctcacattcagaagtaaaaaatttgcaaagcactatattgtcggtttgttaatttttactgttaaacattgaaa |
44130176 |
T |
 |
Q |
101 |
ccttaaattgcat |
113 |
Q |
|
|
||||||||||||| |
|
|
T |
44130175 |
ccttaaattgcat |
44130163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 221
Target Start/End: Complemental strand, 44143139 - 44143106
Alignment:
Q |
188 |
atgctgacaagactgtactaaatgatagctaatt |
221 |
Q |
|
|
|||||||||||| ||||||||||||||||||||| |
|
|
T |
44143139 |
atgctgacaagaatgtactaaatgatagctaatt |
44143106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 44147040 - 44146978
Alignment:
Q |
1 |
tacatagaatttgggtgtctaaaactctgacattcagaagtaaaaaatttgcaaagcactatatt |
65 |
Q |
|
|
|||||||||||| |||||||||||||| | |||| ||||| |||| || ||||||||||||||| |
|
|
T |
44147040 |
tacatagaatttaggtgtctaaaactc--agattctgaagtcaaaagttggcaaagcactatatt |
44146978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University