View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10149_high_6 (Length: 218)

Name: NF10149_high_6
Description: NF10149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10149_high_6
NF10149_high_6
[»] chr1 (2 HSPs)
chr1 (1-201)||(5909692-5909892)
chr1 (4-193)||(5914197-5914386)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 5909892 - 5909692
Alignment:
1 gaagttccaacatgtcccgaattaccaatgccagaatctgcaacatacgaaaacatggacataatagttgcaaagttaccatgcaagtatccagaagaag 100  Q
    ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5909892 gaagttccaacatgtcctgaattaccaatgccagaatttgcaacatacgaaaacatggacataatagttgcaaagttaccatgcaagtatccagaagaag 5909793  T
101 gatgggctagggaagttttaaggttacaagttcatcttatggtagcaaatatggttgtgaagaaagggaagaaagattggaaacggaagagtagagttat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5909792 gatgggctagggaagttttaaggttacaagttcatcttatggtagcaaatatggttgtgaagaaagggaagaaagattggaaacggaagagtagagttat 5909693  T
201 t 201  Q
    |    
5909692 t 5909692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 4 - 193
Target Start/End: Complemental strand, 5914386 - 5914197
Alignment:
4 gttccaacatgtcccgaattaccaatgccagaatctgcaacatacgaaaacatggacataatagttgcaaagttaccatgcaagtatccagaagaaggat 103  Q
    ||||||||||||||||| ||||||||||| ||||  |||||||| |||||||||||||||||||||||||||||||||||||||||||||  |||||| |    
5914386 gttccaacatgtcccgagttaccaatgcccgaattcgcaacatatgaaaacatggacataatagttgcaaagttaccatgcaagtatccattagaagggt 5914287  T
104 gggctagggaagttttaaggttacaagttcatcttatggtagcaaatatggttgtgaagaaagggaagaaagattggaaacggaagagta 193  Q
    |||  || ||||||||||||||||||||||||||||| || ||||||||||||||||||||||| || || ||||||||| |||||||||    
5914286 gggggagagaagttttaaggttacaagttcatcttatagttgcaaatatggttgtgaagaaaggaaaaaaggattggaaatggaagagta 5914197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University