View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10149_low_1 (Length: 459)
Name: NF10149_low_1
Description: NF10149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10149_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 17 - 384
Target Start/End: Complemental strand, 43533789 - 43533416
Alignment:
Q |
17 |
agcagagaggccggcagcagatccagcagcacggaggggaaggagtttggcggaagtgaaaagaggaggggaagcaatccatctggcaatggaatttcca |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
43533789 |
agcagagaggccggcagcagatccagcagcacggaggggaaggagtttggcggaagtgaaaagaggagtggaagcaatccatctggcaatggaatttcca |
43533690 |
T |
 |
Q |
117 |
atgtcgacgctgggaccctcaggacccaaggaattaccagtacctaaagtaatagaagctgcaatagcctttaagaaaggg------ttggaattggaat |
210 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
43533689 |
atgtcgacactgggaccctcaggacccaaggaattaccagtacctaaagtaatagaagctgcaatagcctttaagaaagggcgggaattggaattggaat |
43533590 |
T |
 |
Q |
211 |
tggaaagaaggttgagaagagaaacaagaagacctccaaaagcgggaacaagtattacacttttccatgtttcttgaataggagcttctctcaaccatga |
310 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43533589 |
tggaaagaaggttgagaagagaaacaagaagacctccaaaagcgggaacaagtattacacttttccatgtttcttgaataggagcttctctcaaccatga |
43533490 |
T |
 |
Q |
311 |
ggcacctctatcaggaatcccatcccacaacaaatcacgaatttcatgaacctgcatattgatattgatcgatc |
384 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43533489 |
ggcacctctatcaggaatcccatcccacaacaaatcacgaatttcatgaacctgcatattgatattgatcgatc |
43533416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University