View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10149_low_3 (Length: 302)
Name: NF10149_low_3
Description: NF10149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10149_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 290
Target Start/End: Original strand, 16270438 - 16270709
Alignment:
Q |
19 |
cggacatggatgtagtctttcttaggatgtggctcatcactagtttcttccgcatgctttcctgaactgttttcttctcctttactgtttcctgatgtct |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
16270438 |
cggacatggatgtagtctttcttaggatgtggctcatcactagtttcttccgcatgctttcctgaactgttttcttctcctttactgttccctgatgtct |
16270537 |
T |
 |
Q |
119 |
tactcctttttccgtcaccaccgtcatcatcctgcacaaactcaaattcaatacctctactccaataacaaaactaaaattccaaccaaaaaacaagata |
218 |
Q |
|
|
|||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||| |
|
|
T |
16270538 |
tactcctttttccgtcaccaccatcatcattctgcacaaagtcaaattcaatacctctactccaataacaagacttaaattccaaccaaaaaacaatata |
16270637 |
T |
 |
Q |
219 |
gcaatttgaatagacagatccattcttcatattataatagcaaattgcacattattttgagtctgaactctc |
290 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
16270638 |
gcaatttgaatagacagatccattcttcatattataataccaaattgcacattattttgagtctgaactctc |
16270709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University