View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10149_low_6 (Length: 242)
Name: NF10149_low_6
Description: NF10149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10149_low_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 42650225 - 42650448
Alignment:
| Q |
18 |
ctgatcaccttgcttggaaggccaggggggactatagaaccatttggaaaatgtaatagatgattgagcagtaatggtgttggaatagaatggctaagca |
117 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42650225 |
ctgatcaccttgcttggaaggccggaggggactatagaaccatttggaaaatgtaatagatgattgagcagtaatggtgttggaatagaatggctaagca |
42650324 |
T |
|
| Q |
118 |
ggaaatcatgtagctcctctggggctattgagaagtgagataaatctttcatcatttggcattaggaatgtgagatcattgttttgcagttggttggata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
42650325 |
ggaaatcatgtagctcctctggggctattgagaagtgagataaatc-ttcatcatttggcattaggaatgtgagatcattgttttgcatttggttgggta |
42650423 |
T |
|
| Q |
218 |
agctgttgaggattttgaggaggat |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42650424 |
agctgttgaggattttgaggaggat |
42650448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University