View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10150_high_4 (Length: 309)
Name: NF10150_high_4
Description: NF10150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10150_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 20 - 298
Target Start/End: Complemental strand, 36925515 - 36925237
Alignment:
| Q |
20 |
cctatagtttcttgaatgcatttatccttctcctcttgaagatgtattatttctttctccaattgaatgatctgttcctttaaagccgcttccctctgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36925515 |
cctatagtttcttgaatgcatttatccttctcctcttgaagatgtattatttctttctccaattgaatgatctgttcctttaaagccgcttccctctgtt |
36925416 |
T |
 |
| Q |
120 |
gagcatcatccaagaaactgtttgctttggaaattttggaagaaagagtaatggctgcctcatcgtgttgagcttcggtcacagaaaatttgtctatggt |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36925415 |
gagcatcatccaaggaactgtttgctttggaaattttggaagaaagagtaatggctgcctcatcgtgttgagcttcggtcacagaaaatttgtctatggt |
36925316 |
T |
 |
| Q |
220 |
aataaaggcatgcttgaaagagcataggatgcttgggaattccgtgtgcatagtgtctattatagcttgatgtccatct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36925315 |
aataaaggcatgcttgaaagagcataggatgcttgggaattctgtgtgcatagtgtctattatagcttgaagtccatct |
36925237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University