View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10150_high_7 (Length: 253)
Name: NF10150_high_7
Description: NF10150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10150_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 36925269 - 36925043
Alignment:
| Q |
1 |
tgcatagtgtctattatagcttgaagtccatctgatagagctgcatcttgtaaagaaaggtgggacaagaagttaagcgccgttagaaggcaaaggctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36925269 |
tgcatagtgtctattatagcttgaagtccatctgatagagctgcatcttgtaaagaaaggtgggacaagaagttaagcgccgttagaaggcaaaggctgt |
36925170 |
T |
 |
| Q |
101 |
tagcctctgagctagctatgtccttcagaggcatcctgaaagactcttccaggtcagaaagggcctttgcaacaaagttatctgcaatcacttcagaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
36925169 |
tagcctctgagctagctatgtccttcagaggcatcctcaaagactcttccaggtcagaaagggcctttgcaactaagttatctgcagtcacttcagaaac |
36925070 |
T |
 |
| Q |
201 |
acagggtgtgtttatttggccttcatc |
227 |
Q |
| |
|
||| ||||| |||||||||||||||| |
|
|
| T |
36925069 |
acaaagtgtggttatttggccttcatc |
36925043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University