View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10150_low_14 (Length: 256)
Name: NF10150_low_14
Description: NF10150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10150_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 380505 - 380264
Alignment:
| Q |
15 |
gagatgaagcgaaatggttttatttcaacttcaactgttcatggaggcattccggtgccgaagaaacgcgggaggaaaagtaagagtgaaattcttgagc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
380505 |
gagatgaagcgaaatggttttatttcaacttcaactgttcatggaggcattccggtgccaaagaaacgcgggaggaaaagtaagagtgaaattcttgagc |
380406 |
T |
 |
| Q |
115 |
aaaaaatggagcttgcaaagagagaacaaatcaacaggtttacaaagattgcagctccaagtggactactgaatgatttaaaccctgggattattaatca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
380405 |
aaaaaatggagcttgcaaagagagaacaaatcaacaggtttacaaagattgcagctccaagtggactactgaatgatttaaaccctgggattattaatca |
380306 |
T |
 |
| Q |
215 |
tgtaagaaatagaaaacaggtccaaacaattattgaatctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
380305 |
tgtaagaaatagaaaacaggtccaaacaattattgaatctct |
380264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University