View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10150_low_18 (Length: 239)
Name: NF10150_low_18
Description: NF10150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10150_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 25990188 - 25990418
Alignment:
| Q |
1 |
cccaagaaacaatgaagtaaactgaacattttagtgactcaat------------tggcagtgagattgacaaagataaagtacggttcaatcgaatcac |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
25990188 |
cccaagaaacaatgaagtaaactgaacattttagtgattcaatgtatgtttcaattggcagtgagattgacaaagataa----cggttcaatcaaatcac |
25990283 |
T |
|
| Q |
89 |
ggtgtcaatttaacttcatcaaaaccatcgcaatttcaaacattaactaatttcacttgaattagtcaaacacagttctatctaccataatgttcatcag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25990284 |
ggtgtcaatttaacttcatcaaaaccatcgcaatttcaaacattaactaatttcacttggattagtcaaacacagttctatctaccataatgttcatcag |
25990383 |
T |
|
| Q |
189 |
tgatcaccatttccgacgctcttctccgagcaaac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25990384 |
tgatcaccatttccgacgctcttctccgagcaaac |
25990418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University