View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_high_16 (Length: 393)
Name: NF10151A_high_16
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 8 - 373
Target Start/End: Original strand, 5053621 - 5053986
Alignment:
Q |
8 |
atcacagaatttgaatcaatttctgaaaactatacaactactattgtcccttgacggtgacaaaactaatactaccaactatagattatatatagtggtt |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5053621 |
atcacagaatttgaatcaatttctgaaaactatacaactactattgtccctcgacggtggcaaaactaatactaccaactatagattatatatagtggtt |
5053720 |
T |
 |
Q |
108 |
ctagttatgttgcaaacctttatattgcagaaaaatgcaggaataagatgtcaaaattgcggttgcaatactgttgtggagactttaaaatcccttatat |
207 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5053721 |
ctagttacgttgcaaacctttatattgcagaaaaatgcgggaataagatgtcaaaattgcggttgcaatactgttgtggagactttaaaatcccttatat |
5053820 |
T |
 |
Q |
208 |
tacagtggcaatactgttgcggaggcttcaaaatcccttatattaccgtggcaatactgttgcggagacttcaaaatccttgatactgcagttgcaatag |
307 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5053821 |
tacagtggcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcggagacttcaaaatccttgatactgcagttgcaatag |
5053920 |
T |
 |
Q |
308 |
tggttactgatactattggagagacttcaaaatcttttatatcatcgcaattgcgcttgcagaaaa |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
T |
5053921 |
tggttactgatactattggagagacttcaaaatcttttatatggtggcaattgcgcttgcagaaaa |
5053986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University