View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_high_20 (Length: 345)
Name: NF10151A_high_20
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 5e-44; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 6330555 - 6330398
Alignment:
Q |
9 |
agaacataaggccattggatttaccaacttaaccgctagaacaagctaggcaactatctattgttgcgcgcaacacatgtatatatgatataatttctta |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| || |||||||||| ||||||| ||||||||||||| |
|
|
T |
6330555 |
agaacataaggccattggatttaccaacttaaccgctagaacaagctaggcaattatccattctt--gcgcaacaca--tatatataatataatttctta |
6330460 |
T |
 |
Q |
109 |
taaaatctttgtaatcatacctattaaaaattaannnnnnnagggttgggatgagtcatgac |
170 |
Q |
|
|
|||||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||| |
|
|
T |
6330459 |
taaaatctttctaaccatacctattaaaaattaatttttttagggttggggtgagtcatgac |
6330398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 242 - 341
Target Start/End: Complemental strand, 6330274 - 6330173
Alignment:
Q |
242 |
aacttgcaccgtagagaatcaaacctaagaccaactcaagtgggttgaaaaggctcattttctagtttaaaaaataatg--atgcatttagatttgttat |
339 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||| |
|
|
T |
6330274 |
aacttgcaccgtagagaatcgaacctaagaccaactcaagtgggttgaaaaggctcattttctagtttagaaaataatgatatacatttagatttgttat |
6330175 |
T |
 |
Q |
340 |
tg |
341 |
Q |
|
|
|| |
|
|
T |
6330174 |
tg |
6330173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 242
Target Start/End: Complemental strand, 6330387 - 6330345
Alignment:
Q |
200 |
tgtgtgtttcgtgtctgtatctatgcttcataagttactagta |
242 |
Q |
|
|
|||||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
6330387 |
tgtgtgtttcgtgtctgtatctatacttcataggttactagta |
6330345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University